rna-seq sequence read archive (sra) files for tomato Search Results


hela cells  (ATCC)
96
ATCC hela cells
Hela Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rna-seq+sequence+read+archive+(sra)+files+for+tomato/Sp2%2FmIL-6/pmc06224606__mmc7-293-6-123
Average 96 stars, based on 1 article reviews
hela cells - by Bioz Stars, 2026-11
96/100 stars
  Buy from Supplier
mouse c2c12 encode encsr000aig experimental models  (ATCC)
99
ATCC mouse c2c12 encode encsr000aig experimental models
Figure 2. MyoD and Myf5 Suppressed the BA Fate by Transcriptionally Repressing Prdm16 (A) FACS-isolated MPCs from 2-month-old wild-type mice were first transfected with different siRNAs as indicated. Cells were then cultured in the pro-adipogenic media for 5 days followed by oil red O staining (top panels; scale bar, 50 mm) or UCP1 immunostaining (red) (bottom panels; scale bar, 20 mm). The ratio of the UCP1+ BAs was quantified by counting more than 100 cells from three randomly chosen fields. The nuclei were counterstained by DAPI (blue). (B) FACS-isolated MPCs were infected with adenoviruses expressing shLacZ or shMyoD (n = 3 mice). The mRNA expression of selected genes was measured by qRT-PCR 36 hr after infection. (C) Quadruplicate <t>C2C12</t> cells were first transfected with siRNAs as indicated and then cultured in the pro-adipogenic media for 4 days. Left: 3/4 of cells were subjected to oil red O staining. Scale bar, 50 mm. Middle: Quantification of the intracellular oil red O by measuring the absorbance at 500 nm. Right: 1/4 of the cells were subjected to western blotting. Data are presented as mean ± SD. *p < 0.05, **p < 0.01, ***p < 0.001.
Mouse C2c12 Encode Encsr000aig Experimental Models, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rna-seq+sequence+read+archive+(sra)+files+for+tomato/C2C12/pm28535373-171-35-45
Average 99 stars, based on 1 article reviews
mouse c2c12 encode encsr000aig experimental models - by Bioz Stars, 2026-11
99/100 stars
  Buy from Supplier
national center for biotechnology information sequence read archive  (Biotechnology Information)
90
Biotechnology Information national center for biotechnology information sequence read archive
Figure 2. MyoD and Myf5 Suppressed the BA Fate by Transcriptionally Repressing Prdm16 (A) FACS-isolated MPCs from 2-month-old wild-type mice were first transfected with different siRNAs as indicated. Cells were then cultured in the pro-adipogenic media for 5 days followed by oil red O staining (top panels; scale bar, 50 mm) or UCP1 immunostaining (red) (bottom panels; scale bar, 20 mm). The ratio of the UCP1+ BAs was quantified by counting more than 100 cells from three randomly chosen fields. The nuclei were counterstained by DAPI (blue). (B) FACS-isolated MPCs were infected with adenoviruses expressing shLacZ or shMyoD (n = 3 mice). The mRNA expression of selected genes was measured by qRT-PCR 36 hr after infection. (C) Quadruplicate <t>C2C12</t> cells were first transfected with siRNAs as indicated and then cultured in the pro-adipogenic media for 4 days. Left: 3/4 of cells were subjected to oil red O staining. Scale bar, 50 mm. Middle: Quantification of the intracellular oil red O by measuring the absorbance at 500 nm. Right: 1/4 of the cells were subjected to western blotting. Data are presented as mean ± SD. *p < 0.05, **p < 0.01, ***p < 0.001.
National Center For Biotechnology Information Sequence Read Archive, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rna-seq+sequence+read+archive+(sra)+files+for+tomato/sequence+read+archive/pmc09305896-272-12-10
Average 90 stars, based on 1 article reviews
national center for biotechnology information sequence read archive - by Bioz Stars, 2026-11
90/100 stars
  Buy from Supplier
ncbi sra  (Biotechnology Information)
90
Biotechnology Information ncbi sra
Figure 2. MyoD and Myf5 Suppressed the BA Fate by Transcriptionally Repressing Prdm16 (A) FACS-isolated MPCs from 2-month-old wild-type mice were first transfected with different siRNAs as indicated. Cells were then cultured in the pro-adipogenic media for 5 days followed by oil red O staining (top panels; scale bar, 50 mm) or UCP1 immunostaining (red) (bottom panels; scale bar, 20 mm). The ratio of the UCP1+ BAs was quantified by counting more than 100 cells from three randomly chosen fields. The nuclei were counterstained by DAPI (blue). (B) FACS-isolated MPCs were infected with adenoviruses expressing shLacZ or shMyoD (n = 3 mice). The mRNA expression of selected genes was measured by qRT-PCR 36 hr after infection. (C) Quadruplicate <t>C2C12</t> cells were first transfected with siRNAs as indicated and then cultured in the pro-adipogenic media for 4 days. Left: 3/4 of cells were subjected to oil red O staining. Scale bar, 50 mm. Middle: Quantification of the intracellular oil red O by measuring the absorbance at 500 nm. Right: 1/4 of the cells were subjected to western blotting. Data are presented as mean ± SD. *p < 0.05, **p < 0.01, ***p < 0.001.
Ncbi Sra, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rna-seq+sequence+read+archive+(sra)+files+for+tomato/ncbi+sra/pmc09892639-54-14-12
Average 90 stars, based on 1 article reviews
ncbi sra - by Bioz Stars, 2026-11
90/100 stars
  Buy from Supplier
sequence read archive database  (Biotechnology Information)
90
Biotechnology Information sequence read archive database
Figure 2. MyoD and Myf5 Suppressed the BA Fate by Transcriptionally Repressing Prdm16 (A) FACS-isolated MPCs from 2-month-old wild-type mice were first transfected with different siRNAs as indicated. Cells were then cultured in the pro-adipogenic media for 5 days followed by oil red O staining (top panels; scale bar, 50 mm) or UCP1 immunostaining (red) (bottom panels; scale bar, 20 mm). The ratio of the UCP1+ BAs was quantified by counting more than 100 cells from three randomly chosen fields. The nuclei were counterstained by DAPI (blue). (B) FACS-isolated MPCs were infected with adenoviruses expressing shLacZ or shMyoD (n = 3 mice). The mRNA expression of selected genes was measured by qRT-PCR 36 hr after infection. (C) Quadruplicate <t>C2C12</t> cells were first transfected with siRNAs as indicated and then cultured in the pro-adipogenic media for 4 days. Left: 3/4 of cells were subjected to oil red O staining. Scale bar, 50 mm. Middle: Quantification of the intracellular oil red O by measuring the absorbance at 500 nm. Right: 1/4 of the cells were subjected to western blotting. Data are presented as mean ± SD. *p < 0.05, **p < 0.01, ***p < 0.001.
Sequence Read Archive Database, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rna-seq+sequence+read+archive+(sra)+files+for+tomato/sequence+read+archive+database/pmc07145481-778-13-11
Average 90 stars, based on 1 article reviews
sequence read archive database - by Bioz Stars, 2026-11
90/100 stars
  Buy from Supplier
paper sra prjna622985 chip seq data  (ATCC)
93
ATCC paper sra prjna622985 chip seq data
Figure 2. MyoD and Myf5 Suppressed the BA Fate by Transcriptionally Repressing Prdm16 (A) FACS-isolated MPCs from 2-month-old wild-type mice were first transfected with different siRNAs as indicated. Cells were then cultured in the pro-adipogenic media for 5 days followed by oil red O staining (top panels; scale bar, 50 mm) or UCP1 immunostaining (red) (bottom panels; scale bar, 20 mm). The ratio of the UCP1+ BAs was quantified by counting more than 100 cells from three randomly chosen fields. The nuclei were counterstained by DAPI (blue). (B) FACS-isolated MPCs were infected with adenoviruses expressing shLacZ or shMyoD (n = 3 mice). The mRNA expression of selected genes was measured by qRT-PCR 36 hr after infection. (C) Quadruplicate <t>C2C12</t> cells were first transfected with siRNAs as indicated and then cultured in the pro-adipogenic media for 4 days. Left: 3/4 of cells were subjected to oil red O staining. Scale bar, 50 mm. Middle: Quantification of the intracellular oil red O by measuring the absorbance at 500 nm. Right: 1/4 of the cells were subjected to western blotting. Data are presented as mean ± SD. *p < 0.05, **p < 0.01, ***p < 0.001.
Paper Sra Prjna622985 Chip Seq Data, supplied by ATCC, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rna-seq+sequence+read+archive+(sra)+files+for+tomato/Candida+krusei+(Castellani)+Berkhout/pm34525369-614-149-163
Average 93 stars, based on 1 article reviews
paper sra prjna622985 chip seq data - by Bioz Stars, 2026-11
93/100 stars
  Buy from Supplier
sequence read archive (sra) database  (Biotechnology Information)
90
Biotechnology Information sequence read archive (sra) database
Figure 2. MyoD and Myf5 Suppressed the BA Fate by Transcriptionally Repressing Prdm16 (A) FACS-isolated MPCs from 2-month-old wild-type mice were first transfected with different siRNAs as indicated. Cells were then cultured in the pro-adipogenic media for 5 days followed by oil red O staining (top panels; scale bar, 50 mm) or UCP1 immunostaining (red) (bottom panels; scale bar, 20 mm). The ratio of the UCP1+ BAs was quantified by counting more than 100 cells from three randomly chosen fields. The nuclei were counterstained by DAPI (blue). (B) FACS-isolated MPCs were infected with adenoviruses expressing shLacZ or shMyoD (n = 3 mice). The mRNA expression of selected genes was measured by qRT-PCR 36 hr after infection. (C) Quadruplicate <t>C2C12</t> cells were first transfected with siRNAs as indicated and then cultured in the pro-adipogenic media for 4 days. Left: 3/4 of cells were subjected to oil red O staining. Scale bar, 50 mm. Middle: Quantification of the intracellular oil red O by measuring the absorbance at 500 nm. Right: 1/4 of the cells were subjected to western blotting. Data are presented as mean ± SD. *p < 0.05, **p < 0.01, ***p < 0.001.
Sequence Read Archive (Sra) Database, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rna-seq+sequence+read+archive+(sra)+files+for+tomato/sequence+read+archive++sra++database/pmc09371908-318-13-11
Average 90 stars, based on 1 article reviews
sequence read archive (sra) database - by Bioz Stars, 2026-11
90/100 stars
  Buy from Supplier
hi seq 2500  (Illumina Inc)
98
Illumina Inc hi seq 2500
Figure 2. MyoD and Myf5 Suppressed the BA Fate by Transcriptionally Repressing Prdm16 (A) FACS-isolated MPCs from 2-month-old wild-type mice were first transfected with different siRNAs as indicated. Cells were then cultured in the pro-adipogenic media for 5 days followed by oil red O staining (top panels; scale bar, 50 mm) or UCP1 immunostaining (red) (bottom panels; scale bar, 20 mm). The ratio of the UCP1+ BAs was quantified by counting more than 100 cells from three randomly chosen fields. The nuclei were counterstained by DAPI (blue). (B) FACS-isolated MPCs were infected with adenoviruses expressing shLacZ or shMyoD (n = 3 mice). The mRNA expression of selected genes was measured by qRT-PCR 36 hr after infection. (C) Quadruplicate <t>C2C12</t> cells were first transfected with siRNAs as indicated and then cultured in the pro-adipogenic media for 4 days. Left: 3/4 of cells were subjected to oil red O staining. Scale bar, 50 mm. Middle: Quantification of the intracellular oil red O by measuring the absorbance at 500 nm. Right: 1/4 of the cells were subjected to western blotting. Data are presented as mean ± SD. *p < 0.05, **p < 0.01, ***p < 0.001.
Hi Seq 2500, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rna-seq+sequence+read+archive+(sra)+files+for+tomato/HiSeq+2500+Installation+and+Operational+Qualification/pmc05912193-238-12-11
Average 98 stars, based on 1 article reviews
hi seq 2500 - by Bioz Stars, 2026-11
98/100 stars
  Buy from Supplier
2010 sra srs010090 myod chip seq  (ATCC)
96
ATCC 2010 sra srs010090 myod chip seq
Figure 2. MyoD and Myf5 Suppressed the BA Fate by Transcriptionally Repressing Prdm16 (A) FACS-isolated MPCs from 2-month-old wild-type mice were first transfected with different siRNAs as indicated. Cells were then cultured in the pro-adipogenic media for 5 days followed by oil red O staining (top panels; scale bar, 50 mm) or UCP1 immunostaining (red) (bottom panels; scale bar, 20 mm). The ratio of the UCP1+ BAs was quantified by counting more than 100 cells from three randomly chosen fields. The nuclei were counterstained by DAPI (blue). (B) FACS-isolated MPCs were infected with adenoviruses expressing shLacZ or shMyoD (n = 3 mice). The mRNA expression of selected genes was measured by qRT-PCR 36 hr after infection. (C) Quadruplicate <t>C2C12</t> cells were first transfected with siRNAs as indicated and then cultured in the pro-adipogenic media for 4 days. Left: 3/4 of cells were subjected to oil red O staining. Scale bar, 50 mm. Middle: Quantification of the intracellular oil red O by measuring the absorbance at 500 nm. Right: 1/4 of the cells were subjected to western blotting. Data are presented as mean ± SD. *p < 0.05, **p < 0.01, ***p < 0.001.
2010 Sra Srs010090 Myod Chip Seq, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rna-seq+sequence+read+archive+(sra)+files+for+tomato/JB6+Cl+41-5a/pm28535373-171-29-45
Average 96 stars, based on 1 article reviews
2010 sra srs010090 myod chip seq - by Bioz Stars, 2026-11
96/100 stars
  Buy from Supplier
sequence read archive  (Biotechnology Information)
86
Biotechnology Information sequence read archive
Figure 2. MyoD and Myf5 Suppressed the BA Fate by Transcriptionally Repressing Prdm16 (A) FACS-isolated MPCs from 2-month-old wild-type mice were first transfected with different siRNAs as indicated. Cells were then cultured in the pro-adipogenic media for 5 days followed by oil red O staining (top panels; scale bar, 50 mm) or UCP1 immunostaining (red) (bottom panels; scale bar, 20 mm). The ratio of the UCP1+ BAs was quantified by counting more than 100 cells from three randomly chosen fields. The nuclei were counterstained by DAPI (blue). (B) FACS-isolated MPCs were infected with adenoviruses expressing shLacZ or shMyoD (n = 3 mice). The mRNA expression of selected genes was measured by qRT-PCR 36 hr after infection. (C) Quadruplicate <t>C2C12</t> cells were first transfected with siRNAs as indicated and then cultured in the pro-adipogenic media for 4 days. Left: 3/4 of cells were subjected to oil red O staining. Scale bar, 50 mm. Middle: Quantification of the intracellular oil red O by measuring the absorbance at 500 nm. Right: 1/4 of the cells were subjected to western blotting. Data are presented as mean ± SD. *p < 0.05, **p < 0.01, ***p < 0.001.
Sequence Read Archive, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rna-seq+sequence+read+archive+(sra)+files+for+tomato/sequence/pm41063343-313-13-11
Average 86 stars, based on 1 article reviews
sequence read archive - by Bioz Stars, 2026-11
86/100 stars
  Buy from Supplier
musk gland rna sequencing rna-seq data  (Biotechnology Information)
90
Biotechnology Information musk gland rna sequencing rna-seq data
Figure 2. MyoD and Myf5 Suppressed the BA Fate by Transcriptionally Repressing Prdm16 (A) FACS-isolated MPCs from 2-month-old wild-type mice were first transfected with different siRNAs as indicated. Cells were then cultured in the pro-adipogenic media for 5 days followed by oil red O staining (top panels; scale bar, 50 mm) or UCP1 immunostaining (red) (bottom panels; scale bar, 20 mm). The ratio of the UCP1+ BAs was quantified by counting more than 100 cells from three randomly chosen fields. The nuclei were counterstained by DAPI (blue). (B) FACS-isolated MPCs were infected with adenoviruses expressing shLacZ or shMyoD (n = 3 mice). The mRNA expression of selected genes was measured by qRT-PCR 36 hr after infection. (C) Quadruplicate <t>C2C12</t> cells were first transfected with siRNAs as indicated and then cultured in the pro-adipogenic media for 4 days. Left: 3/4 of cells were subjected to oil red O staining. Scale bar, 50 mm. Middle: Quantification of the intracellular oil red O by measuring the absorbance at 500 nm. Right: 1/4 of the cells were subjected to western blotting. Data are presented as mean ± SD. *p < 0.05, **p < 0.01, ***p < 0.001.
Musk Gland Rna Sequencing Rna Seq Data, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rna-seq+sequence+read+archive+(sra)+files+for+tomato/musk+gland+rna+sequencing+rna+seq+data/pmc05906906-71-3-23
Average 90 stars, based on 1 article reviews
musk gland rna sequencing rna-seq data - by Bioz Stars, 2026-11
90/100 stars
  Buy from Supplier
sequence read archive sra database  (Biotechnology Information)
86
Biotechnology Information sequence read archive sra database
Figure 2. MyoD and Myf5 Suppressed the BA Fate by Transcriptionally Repressing Prdm16 (A) FACS-isolated MPCs from 2-month-old wild-type mice were first transfected with different siRNAs as indicated. Cells were then cultured in the pro-adipogenic media for 5 days followed by oil red O staining (top panels; scale bar, 50 mm) or UCP1 immunostaining (red) (bottom panels; scale bar, 20 mm). The ratio of the UCP1+ BAs was quantified by counting more than 100 cells from three randomly chosen fields. The nuclei were counterstained by DAPI (blue). (B) FACS-isolated MPCs were infected with adenoviruses expressing shLacZ or shMyoD (n = 3 mice). The mRNA expression of selected genes was measured by qRT-PCR 36 hr after infection. (C) Quadruplicate <t>C2C12</t> cells were first transfected with siRNAs as indicated and then cultured in the pro-adipogenic media for 4 days. Left: 3/4 of cells were subjected to oil red O staining. Scale bar, 50 mm. Middle: Quantification of the intracellular oil red O by measuring the absorbance at 500 nm. Right: 1/4 of the cells were subjected to western blotting. Data are presented as mean ± SD. *p < 0.05, **p < 0.01, ***p < 0.001.
Sequence Read Archive Sra Database, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rna-seq+sequence+read+archive+(sra)+files+for+tomato/biotechnology+information+ncbi+sequence/pmc12937326-221-16-14
Average 86 stars, based on 1 article reviews
sequence read archive sra database - by Bioz Stars, 2026-11
86/100 stars
  Buy from Supplier

Image Search Results


Figure 2. MyoD and Myf5 Suppressed the BA Fate by Transcriptionally Repressing Prdm16 (A) FACS-isolated MPCs from 2-month-old wild-type mice were first transfected with different siRNAs as indicated. Cells were then cultured in the pro-adipogenic media for 5 days followed by oil red O staining (top panels; scale bar, 50 mm) or UCP1 immunostaining (red) (bottom panels; scale bar, 20 mm). The ratio of the UCP1+ BAs was quantified by counting more than 100 cells from three randomly chosen fields. The nuclei were counterstained by DAPI (blue). (B) FACS-isolated MPCs were infected with adenoviruses expressing shLacZ or shMyoD (n = 3 mice). The mRNA expression of selected genes was measured by qRT-PCR 36 hr after infection. (C) Quadruplicate C2C12 cells were first transfected with siRNAs as indicated and then cultured in the pro-adipogenic media for 4 days. Left: 3/4 of cells were subjected to oil red O staining. Scale bar, 50 mm. Middle: Quantification of the intracellular oil red O by measuring the absorbance at 500 nm. Right: 1/4 of the cells were subjected to western blotting. Data are presented as mean ± SD. *p < 0.05, **p < 0.01, ***p < 0.001.

Journal: Developmental cell

Article Title: A Molecular Switch Regulating Cell Fate Choice between Muscle Progenitor Cells and Brown Adipocytes.

doi: 10.1016/j.devcel.2017.04.012

Figure Lengend Snippet: Figure 2. MyoD and Myf5 Suppressed the BA Fate by Transcriptionally Repressing Prdm16 (A) FACS-isolated MPCs from 2-month-old wild-type mice were first transfected with different siRNAs as indicated. Cells were then cultured in the pro-adipogenic media for 5 days followed by oil red O staining (top panels; scale bar, 50 mm) or UCP1 immunostaining (red) (bottom panels; scale bar, 20 mm). The ratio of the UCP1+ BAs was quantified by counting more than 100 cells from three randomly chosen fields. The nuclei were counterstained by DAPI (blue). (B) FACS-isolated MPCs were infected with adenoviruses expressing shLacZ or shMyoD (n = 3 mice). The mRNA expression of selected genes was measured by qRT-PCR 36 hr after infection. (C) Quadruplicate C2C12 cells were first transfected with siRNAs as indicated and then cultured in the pro-adipogenic media for 4 days. Left: 3/4 of cells were subjected to oil red O staining. Scale bar, 50 mm. Middle: Quantification of the intracellular oil red O by measuring the absorbance at 500 nm. Right: 1/4 of the cells were subjected to western blotting. Data are presented as mean ± SD. *p < 0.05, **p < 0.01, ***p < 0.001.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Deposited Data Pax7 RNA-seq in MPC This paper GEO: GSE97690 ChIP-seq of MyoD binding regions in C2C12 myoblasts at 50% confluency Cao et al., 2010 SRA: SRS010090 MyoD ChIP-seq on mouse C2C12 ENCODE ENCSR000AIG Experimental Models: Cell Lines Mouse: C2C12 ATCC CRL-1772 Experimental Models: Organisms/Strains Mouse: Pax7tm2.1(cre/ERT2)Fan/J Jackson Laboratory JAX: 012476 Mouse: Pax7tm1.1Fan/J Jackson Laboratory JAX: 012653 Mouse: Pax7tm1(cre/ERT2)Gaka/J Jackson Laboratory JAX: 017763 Mouse: Gt(ROSA)26Sortm1(EYFP)Cos/J Jackson Laboratory JAX: 006148 Oligonucleotides qPCR primers for gene expression This paper See Table S1 ChIP-qPCR primer for E2f4 E box Fwd: GATGCCTACTTAAAGAGAAACAGG This paper N/A ChIP-qPCR primer for E2f4 E box Rev: CCACTATATTGCCCAAGAACC This paper N/A ChIP-qPCR primer for Prdm16#1 Fwd: CGACGAAGAGGATGATGAACAC This paper N/A ChIP-qPCR primer for Prdm16#1 Rev: TCCCTAGCATTGTCAGTTTGGA This paper N/A ChIP-qPCR primer for Prdm16#2 Fwd: CTTGAAGTTTATTCCCAAGTGGTG This paper N/A ChIP-qPCR primer for Prdm16#2 Rev: GCGAAAGAGAAAGTAAGCCC This paper N/A ChIP-qPCR primer for Pparg Fwd: GACTCAGGGACAGAGTGAGG This paper N/A ChIP-qPCR primer for Pparg Rev: CGGTAGTTCTGGAGACCTGG This paper N/A siRNA sequence for GFP 5’-GCUGACCCUGAAGUUCAUC This paper N/A siRNA sequence for Myod 5’-GCAGAAGUCUGUCCUAGAU This paper N/A siRNA sequence for Myf5 5’-CUAAUUUGUUUCUUGGCCU This paper N/A siRNA sequence for Prdm16 5’-GAAGAGCGUGAGUACAAAU This paper N/A siRNA sequence for Pax7 5’-GAAUCAAGUUCGGGAAGAA This paper N/A siRNA sequence for E2f4 5’-GCCAGAAGAAGUACCAGAU This paper N/A siRNA sequence for p107 5’-GCCCUGAUUUAAUGAAAGA This paper N/A siRNA sequence for p130 5’-GGCCGUUAAUAAGGCAUAU This paper N/A Negative control miRNA inhibitor Ribobio Cat#miR02201-1-5 Mir-133a inhibitor Ribobio Cat#miR20003473-1-5 Recombinant DNA pGL3-Basic Vector Promega Cat#E1751 pGL3-Promoter Vector Promega Cat#E1761 pAd/BLOCK-iT-DEST RNAi Gateway Vector ThermoFisher Cat#V49220 (Continued on next page) Developmental Cell 41, 382–391.e1–e5, May 22, 2017 e2

Techniques: Isolation, Transfection, Cell Culture, Staining, Immunostaining, Infection, Expressing, Quantitative RT-PCR, Western Blot

Figure 3. E2f4 Is a Direct Transcription Target of MyoD/Myf5 MPCs used below Were Isolated by FACS from 2-Month-Old Wild-Type Mice (A) Sorted cells were fixed after either 1 hr of plating (i.e., quiescent satellite cells or QSC) or 1 day of culturing (i.e., activated satellite cells or ASC) followed by immunostaining for E2F4 (green). (B) MPCs from three mice were separately infected with adenoviruses expressing indicated shRNAs; 36 h later, the E2f4 mRNA levels were measured by qRT-PCR. (C) MPCs were transfected with siRNAs as indicated. E2F4 protein levels were measured by western blotting. (D) Top: schematic of the E2f4 promoter. TSS, transcription start site; blue boxes, exons; black box, the E box. Bottom: ChIP assays (n = 3) were performed using lysates from proliferating C2C12 myoblasts with a MyoD antibody or an immunoglobulin G control. The fold enrichment of MyoD on the specific E box in the E2f4 promoter is shown. NS, non-specific site. (E and F) MPCs (E) and C2C12 myoblasts (F) were transfected with siRNAs as indicated; 24 hr post transfection, cells were cultured in the pro-adipogenic media for 4 days followed by oil red O staining. Data are presented as mean ± SD. **p < 0.01, ***p < 0.001. Scale bars, 30 mm.

Journal: Developmental cell

Article Title: A Molecular Switch Regulating Cell Fate Choice between Muscle Progenitor Cells and Brown Adipocytes.

doi: 10.1016/j.devcel.2017.04.012

Figure Lengend Snippet: Figure 3. E2f4 Is a Direct Transcription Target of MyoD/Myf5 MPCs used below Were Isolated by FACS from 2-Month-Old Wild-Type Mice (A) Sorted cells were fixed after either 1 hr of plating (i.e., quiescent satellite cells or QSC) or 1 day of culturing (i.e., activated satellite cells or ASC) followed by immunostaining for E2F4 (green). (B) MPCs from three mice were separately infected with adenoviruses expressing indicated shRNAs; 36 h later, the E2f4 mRNA levels were measured by qRT-PCR. (C) MPCs were transfected with siRNAs as indicated. E2F4 protein levels were measured by western blotting. (D) Top: schematic of the E2f4 promoter. TSS, transcription start site; blue boxes, exons; black box, the E box. Bottom: ChIP assays (n = 3) were performed using lysates from proliferating C2C12 myoblasts with a MyoD antibody or an immunoglobulin G control. The fold enrichment of MyoD on the specific E box in the E2f4 promoter is shown. NS, non-specific site. (E and F) MPCs (E) and C2C12 myoblasts (F) were transfected with siRNAs as indicated; 24 hr post transfection, cells were cultured in the pro-adipogenic media for 4 days followed by oil red O staining. Data are presented as mean ± SD. **p < 0.01, ***p < 0.001. Scale bars, 30 mm.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Deposited Data Pax7 RNA-seq in MPC This paper GEO: GSE97690 ChIP-seq of MyoD binding regions in C2C12 myoblasts at 50% confluency Cao et al., 2010 SRA: SRS010090 MyoD ChIP-seq on mouse C2C12 ENCODE ENCSR000AIG Experimental Models: Cell Lines Mouse: C2C12 ATCC CRL-1772 Experimental Models: Organisms/Strains Mouse: Pax7tm2.1(cre/ERT2)Fan/J Jackson Laboratory JAX: 012476 Mouse: Pax7tm1.1Fan/J Jackson Laboratory JAX: 012653 Mouse: Pax7tm1(cre/ERT2)Gaka/J Jackson Laboratory JAX: 017763 Mouse: Gt(ROSA)26Sortm1(EYFP)Cos/J Jackson Laboratory JAX: 006148 Oligonucleotides qPCR primers for gene expression This paper See Table S1 ChIP-qPCR primer for E2f4 E box Fwd: GATGCCTACTTAAAGAGAAACAGG This paper N/A ChIP-qPCR primer for E2f4 E box Rev: CCACTATATTGCCCAAGAACC This paper N/A ChIP-qPCR primer for Prdm16#1 Fwd: CGACGAAGAGGATGATGAACAC This paper N/A ChIP-qPCR primer for Prdm16#1 Rev: TCCCTAGCATTGTCAGTTTGGA This paper N/A ChIP-qPCR primer for Prdm16#2 Fwd: CTTGAAGTTTATTCCCAAGTGGTG This paper N/A ChIP-qPCR primer for Prdm16#2 Rev: GCGAAAGAGAAAGTAAGCCC This paper N/A ChIP-qPCR primer for Pparg Fwd: GACTCAGGGACAGAGTGAGG This paper N/A ChIP-qPCR primer for Pparg Rev: CGGTAGTTCTGGAGACCTGG This paper N/A siRNA sequence for GFP 5’-GCUGACCCUGAAGUUCAUC This paper N/A siRNA sequence for Myod 5’-GCAGAAGUCUGUCCUAGAU This paper N/A siRNA sequence for Myf5 5’-CUAAUUUGUUUCUUGGCCU This paper N/A siRNA sequence for Prdm16 5’-GAAGAGCGUGAGUACAAAU This paper N/A siRNA sequence for Pax7 5’-GAAUCAAGUUCGGGAAGAA This paper N/A siRNA sequence for E2f4 5’-GCCAGAAGAAGUACCAGAU This paper N/A siRNA sequence for p107 5’-GCCCUGAUUUAAUGAAAGA This paper N/A siRNA sequence for p130 5’-GGCCGUUAAUAAGGCAUAU This paper N/A Negative control miRNA inhibitor Ribobio Cat#miR02201-1-5 Mir-133a inhibitor Ribobio Cat#miR20003473-1-5 Recombinant DNA pGL3-Basic Vector Promega Cat#E1751 pGL3-Promoter Vector Promega Cat#E1761 pAd/BLOCK-iT-DEST RNAi Gateway Vector ThermoFisher Cat#V49220 (Continued on next page) Developmental Cell 41, 382–391.e1–e5, May 22, 2017 e2

Techniques: Isolation, Immunostaining, Infection, Expressing, Quantitative RT-PCR, Transfection, Western Blot, Control, Cell Culture, Staining

Figure 4. Prdm16 Is a Direct Transcription Target of the E2F4/p107/p130 Repressive Complex (A) FACS-isolated MPCs in triplicate were transfected with siRNAs as indicated. Relative gene expression was measured by qRT-PCR 24 hr after transfection. (B) Top: schematic of the Prdm16 promoter. #1 and #2 indicate the predicted E2F4 binding sites (black boxes). Blue box, exons. Bottom: ChIP assays (n = 3) were performed using lysates from proliferating C2C12 myoblasts with specific antibodies as indicated. The fold enrichment of E2F4, p107, or p130 on two potential E2F4 binding sites in the Prdm16 promoter and a known E2F4 binding site in the PPARg promoter (control) is shown. (C–F) C2C12 cells in triplicate were co-transfected with various luciferase reporters, siRNAs, and/or cDNA expression vectors as indicated. Cells were harvested 24 hr after transfection and luciferase activities were measured. In (C) and (D), a luciferase reporter construct carrying a 1.5-kb mouse Prdm16 proximal promoter was used. In (E), two luciferase reporter constructs were used, each carrying a short fragment of the Prdm16 promoter with one of the two (i.e., #1, #2) potential E2F4 binding sites. In (F), two luciferase reporter constructs were used, one carrying three copies of the wild-type E2F4 binding site (CGCAGC) found in site #2 and the other three copies of the mutated E2F4 binding site (CTCCTC). In (A)–(F), Fold changes were calculated. Data are presented as means ± SD. *p < 0.05, **p < 0.01, ***p < 0.001.

Journal: Developmental cell

Article Title: A Molecular Switch Regulating Cell Fate Choice between Muscle Progenitor Cells and Brown Adipocytes.

doi: 10.1016/j.devcel.2017.04.012

Figure Lengend Snippet: Figure 4. Prdm16 Is a Direct Transcription Target of the E2F4/p107/p130 Repressive Complex (A) FACS-isolated MPCs in triplicate were transfected with siRNAs as indicated. Relative gene expression was measured by qRT-PCR 24 hr after transfection. (B) Top: schematic of the Prdm16 promoter. #1 and #2 indicate the predicted E2F4 binding sites (black boxes). Blue box, exons. Bottom: ChIP assays (n = 3) were performed using lysates from proliferating C2C12 myoblasts with specific antibodies as indicated. The fold enrichment of E2F4, p107, or p130 on two potential E2F4 binding sites in the Prdm16 promoter and a known E2F4 binding site in the PPARg promoter (control) is shown. (C–F) C2C12 cells in triplicate were co-transfected with various luciferase reporters, siRNAs, and/or cDNA expression vectors as indicated. Cells were harvested 24 hr after transfection and luciferase activities were measured. In (C) and (D), a luciferase reporter construct carrying a 1.5-kb mouse Prdm16 proximal promoter was used. In (E), two luciferase reporter constructs were used, each carrying a short fragment of the Prdm16 promoter with one of the two (i.e., #1, #2) potential E2F4 binding sites. In (F), two luciferase reporter constructs were used, one carrying three copies of the wild-type E2F4 binding site (CGCAGC) found in site #2 and the other three copies of the mutated E2F4 binding site (CTCCTC). In (A)–(F), Fold changes were calculated. Data are presented as means ± SD. *p < 0.05, **p < 0.01, ***p < 0.001.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Deposited Data Pax7 RNA-seq in MPC This paper GEO: GSE97690 ChIP-seq of MyoD binding regions in C2C12 myoblasts at 50% confluency Cao et al., 2010 SRA: SRS010090 MyoD ChIP-seq on mouse C2C12 ENCODE ENCSR000AIG Experimental Models: Cell Lines Mouse: C2C12 ATCC CRL-1772 Experimental Models: Organisms/Strains Mouse: Pax7tm2.1(cre/ERT2)Fan/J Jackson Laboratory JAX: 012476 Mouse: Pax7tm1.1Fan/J Jackson Laboratory JAX: 012653 Mouse: Pax7tm1(cre/ERT2)Gaka/J Jackson Laboratory JAX: 017763 Mouse: Gt(ROSA)26Sortm1(EYFP)Cos/J Jackson Laboratory JAX: 006148 Oligonucleotides qPCR primers for gene expression This paper See Table S1 ChIP-qPCR primer for E2f4 E box Fwd: GATGCCTACTTAAAGAGAAACAGG This paper N/A ChIP-qPCR primer for E2f4 E box Rev: CCACTATATTGCCCAAGAACC This paper N/A ChIP-qPCR primer for Prdm16#1 Fwd: CGACGAAGAGGATGATGAACAC This paper N/A ChIP-qPCR primer for Prdm16#1 Rev: TCCCTAGCATTGTCAGTTTGGA This paper N/A ChIP-qPCR primer for Prdm16#2 Fwd: CTTGAAGTTTATTCCCAAGTGGTG This paper N/A ChIP-qPCR primer for Prdm16#2 Rev: GCGAAAGAGAAAGTAAGCCC This paper N/A ChIP-qPCR primer for Pparg Fwd: GACTCAGGGACAGAGTGAGG This paper N/A ChIP-qPCR primer for Pparg Rev: CGGTAGTTCTGGAGACCTGG This paper N/A siRNA sequence for GFP 5’-GCUGACCCUGAAGUUCAUC This paper N/A siRNA sequence for Myod 5’-GCAGAAGUCUGUCCUAGAU This paper N/A siRNA sequence for Myf5 5’-CUAAUUUGUUUCUUGGCCU This paper N/A siRNA sequence for Prdm16 5’-GAAGAGCGUGAGUACAAAU This paper N/A siRNA sequence for Pax7 5’-GAAUCAAGUUCGGGAAGAA This paper N/A siRNA sequence for E2f4 5’-GCCAGAAGAAGUACCAGAU This paper N/A siRNA sequence for p107 5’-GCCCUGAUUUAAUGAAAGA This paper N/A siRNA sequence for p130 5’-GGCCGUUAAUAAGGCAUAU This paper N/A Negative control miRNA inhibitor Ribobio Cat#miR02201-1-5 Mir-133a inhibitor Ribobio Cat#miR20003473-1-5 Recombinant DNA pGL3-Basic Vector Promega Cat#E1751 pGL3-Promoter Vector Promega Cat#E1761 pAd/BLOCK-iT-DEST RNAi Gateway Vector ThermoFisher Cat#V49220 (Continued on next page) Developmental Cell 41, 382–391.e1–e5, May 22, 2017 e2

Techniques: Isolation, Transfection, Gene Expression, Quantitative RT-PCR, Binding Assay, Control, Luciferase, Expressing, Construct